tet plko puro vector (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
tet plko puro vector
Tet Plko Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 699 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tet+plko+puro+vector/Tet-pLKO-puro+(Plasmid+%2321915)/pm41904893-185-15-17
Average 96 stars, based on 699 article reviews
Tet Plko Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 699 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tet+plko+puro+vector/Tet-pLKO-puro+(Plasmid+%2321915)/pm41904893-185-15-17
Average 96 stars, based on 699 article reviews
tet plko puro vector - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
shRNA:Article Title: A SETD2-CDK1-lamin axis maintains nuclear morphology and genome stability. Article Snippet: Histone methyltransferases regulate chromatin organization and are frequently mutated in human diseases, including cancer.. One such often mutated methyltransferase, SETD2, associates with transcribing RNA polymerase II and catalyses H3K36me3—a modification that contributes to gene transcription, splicing and DNA repair.. Although its catalytic function is well-characterized, its non-catalytic roles remain unclear. Article Title: BMP4-driven morphogenetic reprogramming sustains EGFR-TKI resistance via SOX2 suppression and EMT activation. Article Snippet: .. To generate the inducible knockdown construct, the BMP4 shRNA sequence (5′-GCGACACTTCTGCAGATGTTT-3′) was cloned into the Article Title: SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia Article Snippet: For this purpose, we interrogated the GPP Web Portal ( https://portals.broadinstitute.org/gpp/public/gene/search_clones ) and obtained the shRNA that displayed the highest predicted silencing score: shRNA1, TCAGGGAAGGTGGTCATAATA (TRCN0000373635). .. The shRNA was cloned into the Clone Assay:Article Title: A SETD2-CDK1-lamin axis maintains nuclear morphology and genome stability. Article Snippet: Histone methyltransferases regulate chromatin organization and are frequently mutated in human diseases, including cancer.. One such often mutated methyltransferase, SETD2, associates with transcribing RNA polymerase II and catalyses H3K36me3—a modification that contributes to gene transcription, splicing and DNA repair.. Although its catalytic function is well-characterized, its non-catalytic roles remain unclear. Article Title: Dissecting the tRNA Fragment tRF3E–Nucleolin Interaction: Implications in Breast Cancer Article Snippet: .. First, the sequences encoding for wt tRF3E or M19–24 were cloned into Article Title: Dissecting the tRNA Fragment tRF3E-Nucleolin Interaction: Implications in Breast Cancer. Article Snippet: .. First, the sequences encoding for wt tRF3E or M19–24 were cloned into Article Title: BMP4-driven morphogenetic reprogramming sustains EGFR-TKI resistance via SOX2 suppression and EMT activation. Article Snippet: .. To generate the inducible knockdown construct, the BMP4 shRNA sequence (5′-GCGACACTTCTGCAGATGTTT-3′) was cloned into the Article Title: Mitochondrial glutathione import enables breast cancer metastasis via integrated stress response signaling Article Snippet: Cells assigned to the hypoxia treatment were placed in a hypoxia chamber and exposed to a hypoxic gas mixture (94% N 2 , 5% CO 2 , and 1% O 2 ) for indicated time points. sgRNA sequences were synthesized by IDT and cloned with T4 ligase (NEB) into lentiCRISPR-v2 (Addgene 52961) ( Slc25a39, SLC25A39, control, DELE1 ), linearized with BsmBI (NEB). .. Knockdown was confirmed by western blotting. cDNAs (ATF4, SLC25A39, DELE1) were synthesized by Twist Biosciences and cloned using Gibson Assembly (NEB) into pMXS-IRES-BLAST (Cell Biolabs RTV-016) linearized with BamHI and NotI. shRNAs were cloned into Article Title: SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia Article Snippet: For this purpose, we interrogated the GPP Web Portal ( https://portals.broadinstitute.org/gpp/public/gene/search_clones ) and obtained the shRNA that displayed the highest predicted silencing score: shRNA1, TCAGGGAAGGTGGTCATAATA (TRCN0000373635). .. The shRNA was cloned into the Article Title: Elevated nonhomologous end-joining by AATF enables efficient DNA damage repair and therapeutic resistance in glioblastoma Article Snippet: .. Clones expressing AATF or XRCC4 shRNAs were cloned into the pLKO.1 TRC vector (Addgene); Clones expressing AATF or XRCC4 Dox-induced shRNAs were cloned into the Plasmid Preparation:Article Title: A SETD2-CDK1-lamin axis maintains nuclear morphology and genome stability. Article Snippet: Histone methyltransferases regulate chromatin organization and are frequently mutated in human diseases, including cancer.. One such often mutated methyltransferase, SETD2, associates with transcribing RNA polymerase II and catalyses H3K36me3—a modification that contributes to gene transcription, splicing and DNA repair.. Although its catalytic function is well-characterized, its non-catalytic roles remain unclear. Article Title: Dissecting the tRNA Fragment tRF3E–Nucleolin Interaction: Implications in Breast Cancer Article Snippet: .. First, the sequences encoding for wt tRF3E or M19–24 were cloned into Article Title: Dissecting the tRNA Fragment tRF3E-Nucleolin Interaction: Implications in Breast Cancer. Article Snippet: .. First, the sequences encoding for wt tRF3E or M19–24 were cloned into Article Title: BMP4-driven morphogenetic reprogramming sustains EGFR-TKI resistance via SOX2 suppression and EMT activation. Article Snippet: .. To generate the inducible knockdown construct, the BMP4 shRNA sequence (5′-GCGACACTTCTGCAGATGTTT-3′) was cloned into the Article Title: Mitochondrial glutathione import enables breast cancer metastasis via integrated stress response signaling Article Snippet: Cells assigned to the hypoxia treatment were placed in a hypoxia chamber and exposed to a hypoxic gas mixture (94% N 2 , 5% CO 2 , and 1% O 2 ) for indicated time points. sgRNA sequences were synthesized by IDT and cloned with T4 ligase (NEB) into lentiCRISPR-v2 (Addgene 52961) ( Slc25a39, SLC25A39, control, DELE1 ), linearized with BsmBI (NEB). .. Knockdown was confirmed by western blotting. cDNAs (ATF4, SLC25A39, DELE1) were synthesized by Twist Biosciences and cloned using Gibson Assembly (NEB) into pMXS-IRES-BLAST (Cell Biolabs RTV-016) linearized with BamHI and NotI. shRNAs were cloned into Article Title: SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia Article Snippet: For this purpose, we interrogated the GPP Web Portal ( https://portals.broadinstitute.org/gpp/public/gene/search_clones ) and obtained the shRNA that displayed the highest predicted silencing score: shRNA1, TCAGGGAAGGTGGTCATAATA (TRCN0000373635). .. The shRNA was cloned into the Article Title: Elevated nonhomologous end-joining by AATF enables efficient DNA damage repair and therapeutic resistance in glioblastoma Article Snippet: .. Clones expressing AATF or XRCC4 shRNAs were cloned into the pLKO.1 TRC vector (Addgene); Clones expressing AATF or XRCC4 Dox-induced shRNAs were cloned into the Control:Article Title: Dissecting the tRNA Fragment tRF3E–Nucleolin Interaction: Implications in Breast Cancer Article Snippet: .. First, the sequences encoding for wt tRF3E or M19–24 were cloned into Article Title: Dissecting the tRNA Fragment tRF3E-Nucleolin Interaction: Implications in Breast Cancer. Article Snippet: .. First, the sequences encoding for wt tRF3E or M19–24 were cloned into Stable Transfection:Article Title: Dissecting the tRNA Fragment tRF3E–Nucleolin Interaction: Implications in Breast Cancer Article Snippet: .. First, the sequences encoding for wt tRF3E or M19–24 were cloned into Article Title: Dissecting the tRNA Fragment tRF3E-Nucleolin Interaction: Implications in Breast Cancer. Article Snippet: .. First, the sequences encoding for wt tRF3E or M19–24 were cloned into Knockdown:Article Title: Derepressing nuclear pyruvate dehydrogenase induces therapeutic cancer cell reprogramming. Article Snippet: In brief Zhao et al. uncovered a nuclear-restricted acetyl-CoA regulatory mechanism where nucleus-localized pyruvate dehydrogenase complex (nPDC) is constitutively bound and repressed by nuclear protein ELMSAN1.. Pharmacological disruption of the ELMSAN1-nPDC interaction derepresses nPDC activity, synergizes with HDAC1/2 inhibitors, and therapeutically reprograms diverse cancer types to durably lose proliferation, stemness, and cell-of-origin identity.. Pyruvate Article Title: BMP4-driven morphogenetic reprogramming sustains EGFR-TKI resistance via SOX2 suppression and EMT activation. Article Snippet: .. To generate the inducible knockdown construct, the BMP4 shRNA sequence (5′-GCGACACTTCTGCAGATGTTT-3′) was cloned into the Article Title: Mitochondrial glutathione import enables breast cancer metastasis via integrated stress response signaling Article Snippet: Cells assigned to the hypoxia treatment were placed in a hypoxia chamber and exposed to a hypoxic gas mixture (94% N 2 , 5% CO 2 , and 1% O 2 ) for indicated time points. sgRNA sequences were synthesized by IDT and cloned with T4 ligase (NEB) into lentiCRISPR-v2 (Addgene 52961) ( Slc25a39, SLC25A39, control, DELE1 ), linearized with BsmBI (NEB). .. Knockdown was confirmed by western blotting. cDNAs (ATF4, SLC25A39, DELE1) were synthesized by Twist Biosciences and cloned using Gibson Assembly (NEB) into pMXS-IRES-BLAST (Cell Biolabs RTV-016) linearized with BamHI and NotI. shRNAs were cloned into Construct:Article Title: BMP4-driven morphogenetic reprogramming sustains EGFR-TKI resistance via SOX2 suppression and EMT activation. Article Snippet: .. To generate the inducible knockdown construct, the BMP4 shRNA sequence (5′-GCGACACTTCTGCAGATGTTT-3′) was cloned into the Sequencing:Article Title: BMP4-driven morphogenetic reprogramming sustains EGFR-TKI resistance via SOX2 suppression and EMT activation. Article Snippet: .. To generate the inducible knockdown construct, the BMP4 shRNA sequence (5′-GCGACACTTCTGCAGATGTTT-3′) was cloned into the Western Blot:Article Title: Mitochondrial glutathione import enables breast cancer metastasis via integrated stress response signaling Article Snippet: Cells assigned to the hypoxia treatment were placed in a hypoxia chamber and exposed to a hypoxic gas mixture (94% N 2 , 5% CO 2 , and 1% O 2 ) for indicated time points. sgRNA sequences were synthesized by IDT and cloned with T4 ligase (NEB) into lentiCRISPR-v2 (Addgene 52961) ( Slc25a39, SLC25A39, control, DELE1 ), linearized with BsmBI (NEB). .. Knockdown was confirmed by western blotting. cDNAs (ATF4, SLC25A39, DELE1) were synthesized by Twist Biosciences and cloned using Gibson Assembly (NEB) into pMXS-IRES-BLAST (Cell Biolabs RTV-016) linearized with BamHI and NotI. shRNAs were cloned into Synthesized:Article Title: Mitochondrial glutathione import enables breast cancer metastasis via integrated stress response signaling Article Snippet: Cells assigned to the hypoxia treatment were placed in a hypoxia chamber and exposed to a hypoxic gas mixture (94% N 2 , 5% CO 2 , and 1% O 2 ) for indicated time points. sgRNA sequences were synthesized by IDT and cloned with T4 ligase (NEB) into lentiCRISPR-v2 (Addgene 52961) ( Slc25a39, SLC25A39, control, DELE1 ), linearized with BsmBI (NEB). .. Knockdown was confirmed by western blotting. cDNAs (ATF4, SLC25A39, DELE1) were synthesized by Twist Biosciences and cloned using Gibson Assembly (NEB) into pMXS-IRES-BLAST (Cell Biolabs RTV-016) linearized with BamHI and NotI. shRNAs were cloned into Expressing:Article Title: Elevated nonhomologous end-joining by AATF enables efficient DNA damage repair and therapeutic resistance in glioblastoma Article Snippet: .. Clones expressing AATF or XRCC4 shRNAs were cloned into the pLKO.1 TRC vector (Addgene); Clones expressing AATF or XRCC4 Dox-induced shRNAs were cloned into the |